TB-500 comes up often in conversation and rarely with the context attached. Here we lay out the basics in order, then work through the practical considerations.
Updated 2026-06-12. Numbers and descriptions here follow the published literature rather than marketing material.
Published research on the intact protein is substantial, covering actin regulation, cell migration, and wound models. Research using the heptapeptide fragment specifically is far smaller, and much of the circulating material originates in supplier documentation rather than peer-reviewed reports. Where fragment studies do exist, they often employ different sequences, chain lengths, or terminal modifications, which complicates direct comparison across papers. Readers encountering claims about TB-500 should therefore separate evidence about thymosin beta-4 from evidence about the fragment itself.
Discussion of the compound frequently appears alongside other short peptides described as fragments of larger proteins. That grouping is convenient but can be misleading, because fragment length, charge, and modification state determine how a peptide behaves in solution and in any experimental system. A seven-residue acetylated peptide and a full-length protein differ in mass by roughly an order of magnitude, and they cannot be assumed to share distribution or binding properties. Precision about which molecule is under discussion is the single most useful step when reading such material.
Regulatory status differs by country, but TB-500 is not an approved pharmaceutical in major jurisdictions. It is commonly sold as a research chemical for laboratory use, which places responsibility for identity and purity on the supplier and the laboratory. Published human data are limited, and most reports involve preclinical models or cell culture. Questions about whether the fragment mimics all actions of thymosin beta-4, and under which conditions, remain open. Independent verification of any material is therefore a practical requirement in research settings.
TB-500 is a synthetic heptapeptide with the sequence Ac-LKKTETQ. It corresponds to a short N-terminal region of thymosin beta-4, a 43-amino-acid protein found in many cell types. The fragment contains an actin-binding motif, which is one reason it appears in laboratory studies of cell migration and cytoskeletal dynamics. TB-500 is not the full-length protein and is produced as a research chemical rather than an approved therapeutic agent. Its molecular weight is approximately 889 Da.
Several names appear in scientific and commercial contexts for this peptide. The label TB-500 is informal and does not follow standard biochemical nomenclature. Research articles more often describe the compound as a thymosin beta-4 fragment, Tβ4 fragment, or by its sequence Ac-LKKTETQ. Confusing TB-500 with full-length thymosin beta-4 can lead to incorrect assumptions about activity because the fragment lacks the remaining residues of the parent protein. The relationship between fragment and parent protein remains an active area of study.
| Property | Value | Notes |
|---|---|---|
| Reported sequence | Ac-LKKTETQ | Described in most listings as the actin-binding region of thymosin beta-4 |
| Reported molecular weight | Approximately 889 Da | Value shifts with the stated sequence; compare against the certificate of analysis |
| Parent protein length | 43 amino acids | Thymosin beta-4; the fragment covers only a small part of it |
| Common synonyms | TB4 fragment; thymosin beta-4 fragment | Trade-style names rather than formal nomenclature |
| Formal monographs | Not established | Labeling conventions differ by supplier and region |
Controlled human trials of the short fragment are scarce. Much of what appears in review articles is extrapolated from animal models or from studies of the parent protein, and literature searches return a larger body of cardiac and ophthalmic work on thymosin beta-4 than on the abbreviated peptide. Regulatory treatment differs by jurisdiction, and in several countries the material is handled as a research chemical rather than an approved therapeutic. Statements about human benefit should be read as provisional.
Biological interest in this peptide centers on its relationship to actin dynamics. Thymosin beta-4 binds monomeric actin through an LKKTET motif, and a short sequence carrying that motif can compete with other actin-binding proteins in cell-free preparations. Investigators propose that such competition shifts the balance between filament assembly and disassembly, which in turn affects how readily a cell extends protrusions and migrates. Most of the supporting observations come from cultured cells and purified protein systems rather than from intact organisms.
Literature and online discussion often conflate TB-500 with full-length thymosin beta-4, even though the two differ in size and are not interchangeable in analytical terms. The fragment is produced by solid-phase peptide synthesis, and the product is a defined seven-residue chain rather than a biological extract. Because the term is a trade-style label, two vendors may supply materials of the same nominal sequence but different counter-ion content, purity, or water content. Comparisons across studies are therefore difficult unless the exact sequence and purity are reported.
TB-500 is a research peptide whose sequence matches residues 17 to 23 of thymosin beta-4, a 43-residue protein present in most mammalian cells. The chain is seven amino acids long, written as LKKTETQ, and is normally supplied with an acetyl group on the N-terminus. Suppliers list it as a lyophilised powder under the code name TB-500, and the same sequence appears elsewhere in catalogues as the thymosin beta-4 actin-binding fragment. The label is commercial rather than systematic, so no single authority fixes exactly what TB-500 denotes.
Thymosin beta-4 was isolated from calf thymus in the early 1980s and later characterised as an abundant intracellular actin-sequestering protein. Interest in short synthetic fragments grew once the actin-binding motif had been mapped to the middle of the sequence. TB-500 came out of that line of work as a truncated analogue rather than a natural isolate, and it is now sold mainly to laboratories. Published studies on the fragment have been largely in vitro or in animal models, and controlled human trials remain sparse, so claims about effects in people rest on extrapolation.
=== ENSO Costero === Coined by the Peruvian Comité Multisectorial Encargado del Estudio Nacional del Fenómeno El Niño (ENFEN), ENSO Costero, or ENSO Oriental, is the name given to the phenomenon where the sea-surface temperature anomalies are mostly focused on the South American coastline, especially from Peru and Ecuador. Studies point many factors that can lead to its occurrence, sometimes accompanying, or being accompanied, by a larger EP ENSO occurrence, or even displaying opposite conditions from the observed ones in the other Niño regions when accompanied by Modoki variations. ENSO Costero events usually present more localized effects, with warm phases leading to increased rainfall over the coast of Ecuador, northern Peru and the Amazon rainforest, and increased temperatures over the northern Chilean coast, and cold phases leading to droughts on the Peruvian coast, and increased rainfall and decreased temperatures on its mountainous and jungle regions. Because they don't influence the global climate as much as the other types, these events present lesser and weaker correlations to other significant ENSO features, neither always being triggered by Kelvin waves, nor always being accompanied by proportional Southern Oscillation responses. According to the Coastal Niño Index (ICEN), strong El Niño Costero events include 1957, 1982–83, 1997–98 and 2015–16, and La Niña Costera ones include 1950, 1954–56, 1962, 1964, 1966, 1967–68, 1970–71, 1975–76 and 2013.
The 1993 film Jurassic Park (based on the 1990 Michael Crichton novel of the same name) features dinosaurs that were genetically altered so that they could not produce the amino acid lysine. This was known as the "lysine contingency" and was supposed to prevent the cloned dinosaurs from surviving outside the park, forcing them to be dependent on lysine supplements provided by the park's veterinary staff. In reality, no animals are capable of producing lysine (it is an essential amino acid). Autotroph Bradytroph "Regulation of endosomal clathrin and retromer-mediated endosome to Golgi retrograde transport by the J-domain protein RME-8" - The EMBO Journal "Pleiotropic effects of purine auxotrophy inRhizobium meliloti on cell surface molecules" - Springerlink "Auxotrophy and Organic Compounds in the Nutrition of Marine Phytoplankton"
Phytoestrogens are involved in the synthesis of antifungal benzofurans and phytoalexins, such as medicarpin (common in legumes), and sesquiterpenes, such as capsidiol in tobacco. Soybeans naturally produce isoflavones, and are therefore a dietary source for isoflavones. Phytoestrogens are ancient naturally occurring substances, and as dietary phytochemicals they are considered to have coevolved with mammals. In the human diet, phytoestrogens are not the only source of exogenous estrogens. Xenoestrogens (novel, man-made), are found as food additives and ingredients, and also in cosmetics, plastics, and insecticides. Environmentally, they have similar effects as phytoestrogens, making it difficult to clearly separate the action of these two kind of agents in studies.
Endonucleases are enzymes that recognise and cleave nucleic acid segments and they can be used to direct DNA assembly. Of the different types of restriction enzymes, the type II restriction enzymes are the most commonly available and used because their cleavage sites are located near or in their recognition sites. Hence, endonuclease-mediated assembly methods make use of this property to define DNA parts and assembly protocols.
== Preparation and purification == The isotopes of nobelium are mostly produced by bombarding actinide targets (uranium, plutonium, curium, californium, or einsteinium), with the exception of nobelium-262, which is produced as the daughter of lawrencium-262. The most commonly used isotope, 255No, can be produced from bombarding curium-248 or californium-249 with carbon-12: the latter method is more common. Irradiating a 350 μg cm−2 target of californium-249 with three trillion 73 MeV carbon-12 ions per second for ten minutes can produce around 1200 nobelium-255 atoms. Once the nobelium-255 is produced, it can be separated out similarly as used to purify the neighboring actinide mendelevium. The recoil momentum of the produced nobelium-255 atoms is used to bring them physically far away from the target from which they are produced, bringing them onto a thin foil of metal (usually beryllium, aluminium, platinum, or gold) just behind the target in a vacuum: this is usually combined by trapping the nobelium atoms in a gas atmosphere (frequently helium), and carrying them along with a gas jet from a small opening in the reaction chamber. Using a long capillary tube, and including potassium chloride aerosols in the helium gas, the nobelium atoms can be transported over tens of meters. The thin layer of nobelium collected on the foil can then be removed with dilute acid without completely dissolving the foil.
Sources: en.wikipedia.org
== Side effects == Research indicates that cannabidiol may reduce adverse effects of THC, particularly those causing intoxication and sedation, but only at high doses. Safety studies of cannabidiol showed it is well tolerated, but may cause fatigue, somnolence, sedation, diarrhea, or changes in appetite as common adverse effects, with the most common being somnolence and sedation. Side effects of CBD are dose related. Epidiolex documentation lists sleepiness, insomnia and poor quality sleep, decreased appetite, diarrhea, and fatigue. In November 2019, the US Food and Drug Administration (FDA) issued concerns about the safety of cannabidiol, stating that CBD use has potential to cause hepatotoxicity, interfere with the mechanisms of prescription drugs, produce gastrointestinal disorders, or affect alertness and mood. In 2020–2023, the FDA updated its safety concerns about CBD, acknowledging the unknown effects of protracted use, how it affects the developing brain, fetus, or infants during breastfeeding, whether it interacts with dietary supplements or prescription drugs, whether male fertility is affected, and its possible side effects, such as drowsiness. As of September 2019, 1,085 people contacted US poison control centers about CBD-induced illnesses, doubling the number of cases over the 2018 rate and increasing by nine times the case numbers of 2017. Of cases reported in 2019, more than 33% received medical attention and 46 people were admitted to a hospital intensive care unit, possibly due to exposure to other products, or drug interactions with CBD.
== Treatment == The key for managing Sack–Barabas syndrome is for the affected person to be aware of their disease. Close follow up and planning of interventions can significantly prolong and maintain the quality of life of a person with vEDS. Pregnant affected women must take special care due to the increased risk of premature death due to rupture of arteries, bowel or uterine rupture, with a reported mortality rate of 50%. Genetic counseling is recommended for prospective parents with a family history of Ehlers–Danlos syndrome. Affected parents should be aware of the type of Ehlers-Danlos syndrome they have and its mode of inheritance.
Petroleum in some form has been used since ancient times. More than 4,300 years ago, bitumen was mentioned when the Sumerians used it to make boats. A tablet of the legend of the birth of Sargon of Akkad mentions a basket which was closed by straw and bitumen. More than 4,000 years ago, according to Herodotus and Diodorus Siculus, asphalt (bitumen) was used in the construction of the walls and towers of Babylon; there were oil pits near Ardericca and Babylon and a pitch spring on Zakynthos. In Babylon, petroleum was used for road construction, ship caulking, and medicine. The use of petroleum in ancient China dates back more than 2,000 years. The I Ching, one of the earliest Chinese writings, cites that oil in its raw state, without refining, was first discovered, extracted, and used in China in the 1st century BCE. In addition, the Chinese were the first to record the use of petroleum as fuel as early as the 4th century BCE. By 347 CE, oil was produced from bamboo-drilled wells in China. In the 7th century, petroleum was among the essential ingredients for Greek fire, an incendiary projectile weapon that was used by Byzantine Greeks against Arab ships attacking Constantinople. Crude oil was distilled by Persian chemists, with clear descriptions given in Arabic handbooks such as those of Abu Bakr al-Razi. In the 9th century, oil fields were exploited in the area around modern Baku, Azerbaijan. These fields were described by Abu Bakr al-Razi in the 10th century and by Marco Polo in the 13th century, who describes the output of those wells as hundreds of shiploads.
=== Polyadenylation === Based on software analysis of the mRNA sequences various polyadenylation patterns could be identified for the transcription variants . TV1 and TV2 share the same pattern located on exon 10 starting at position 1246 resulting in a 32 nucleotide motif (AGUAGAGUCUGCGCUGUGACCUUCUGUUGGGC). TV3 uses a motif on exon 11 at the position 320. The motif is also 32 nucleotides long, but differs from the sequence used by TV1/2 (AGUGGCUUGUUCCACCUCAGCUCCCAUCUAAC). The difference in the polyadenylation sequence results in a variance of the minimum free energy values of the predicted RNA folding structures (-28.70 kcal/mol, TV1 and TV2 and -16.03 kcal/mol, TV3), which could result in different length of the Poly-A tail. Based on the observation that stable secondary structures result in decreased polyadenylation of the specific site, this might indicate that TV1 and TV2 are less polyadenylated in comparison to TV3.
The British South Africa Police (BSAP) was, for most of its existence, the police force of Southern Rhodesia and Rhodesia (now modern day Zimbabwe, since 1980). It was formed as a paramilitary force of mounted infantrymen in 1889 by Cecil Rhodes' British South Africa Company, from which it took its original name, the British South Africa Company's Police. Initially run directly by the company, it began to operate independently in 1896, at which time it also dropped "Company's" from its name. It thereafter served as Rhodesia's regular police force, retaining its name, until 1980, when it was superseded by the Zimbabwe Republic Police, soon after the country's reconstitution into Zimbabwe in April that year. While it was in the main a law enforcement organisation, the line between police and military was significantly blurred. BSAP officers trained both as policemen and regular soldiers until 1954. BSAP men served in the latter role during the First and Second World Wars, and also provided several support units to the Rhodesian Bush War of the 1960s and 1970s. During the Bush War, the BSAP operated several anti-guerrilla units, most prominently the Police Anti-Terrorist Unit, which tracked and engaged Communist guerrillas; the Support Unit, which was a police field force, nicknamed the "Black Boots" because of the colour of their footwear; and the Civilian African Tracking Unit, composed mostly of black Rhodesian trackers using traditional skills.
Sources: en.wikipedia.org
Most listings describe it as a short acetylated peptide with the sequence Ac-LKKTETQ, presented as a region of thymosin beta-4. The label is a trade-style name rather than a standardized chemical name, so the exact content of a given vial depends on the supplier.
No. Thymosin beta-4 is a protein of 43 amino acids, while TB-500 is described as a short fragment of it. The two differ in size, structure, and the range of interactions each can support.
Naming for research peptides is not centrally coordinated, so vendors set their own labels and specifications. Differences in stated sequence, molecular weight, or purity documentation usually trace back to those independent labeling choices.
TB-500 is a synthetic heptapeptide corresponding to a fragment of thymosin beta-4. It is used in laboratory research and is not an approved drug.