Everything below concerns thymosin beta-4. We keep the language plain, cite what the science says, and separate well-supported claims from open questions.
Last reviewed on 2025-10-08. Where a claim depends on a specific study, the study is described rather than over-claimed.
The fragment most often associated with the name carries the sequence Ac-LKKTETQ, matching residues 17 through 23 of thymosin beta-4. That region holds the actin-binding motif responsible for much of the parent protein's biochemical activity. Apart from N-terminal acetylation the peptide is unmodified and contains no disulfide bonds, so it shows little ordered secondary structure in solution. Full-length thymosin beta-4 is instead a 43-residue polypeptide of roughly 4.9 kDa found widely across mammalian cell types.
Material sold under this label typically arrives as a freeze-dried powder in a sealed vial with a certificate of analysis. Such certificates usually report reversed-phase chromatography purity plus a mass confirmation, and stated purities commonly sit between 95 and 99 percent. Counter-ion identity, residual trifluoroacetate, water content, and peptide net weight are separate specifications that a certificate may or may not include. A purity figure alone does not establish sequence identity, so independent mass verification remains the practical check.
Biological interest in this peptide centers on its relationship to actin dynamics. Thymosin beta-4 binds monomeric actin through an LKKTET motif, and a short sequence carrying that motif can compete with other actin-binding proteins in cell-free preparations. Investigators propose that such competition shifts the balance between filament assembly and disassembly, which in turn affects how readily a cell extends protrusions and migrates. Most of the supporting observations come from cultured cells and purified protein systems rather than from intact organisms.
Animal work has examined the peptide in models of cardiac injury, skin wounding, and corneal repair, with reported outcomes covering cell migration, inflammatory cell influx, and tissue remodeling. Several of those experiments used the full-length protein or longer fragments instead of the seven-residue sequence, which makes direct comparison between reports difficult. Results are generally described as tissue-dependent, and effect sizes vary considerably across laboratories. Independent replication is uneven, so the overall picture is incomplete rather than settled.
| Property | Value | Notes |
|---|---|---|
| Molecular mass | ≈889 Da for the 7-residue fragment | Full-length thymosin beta-4 is ≈4.9 kDa; catalogs differ |
| Appearance | White to off-white powder | Hygroscopic; weight shifts with residual moisture |
| Solubility class | Freely soluble in water | Also dissolves in aqueous buffers; poorly soluble in nonpolar solvents |
| Typical storage temperature | −20 °C, desiccated, protected from light | Once rehydrated, short-term holding at 2-8 °C |
| Typical analytical method | Reversed-phase HPLC with mass spectrometry | Purity by UV absorbance; identity by ESI-MS or MALDI-TOF |
Thymosin beta-4 itself is a small, widely expressed protein that sequesters monomeric actin and participates in cell migration, angiogenesis, and tissue repair. Researchers have examined the shortened fragment as a possible mimic of some of these activities, reasoning that the actin-binding motif lies within the first few residues. Binding to monomeric actin has been observed in cell-free systems. Whether the fragment reproduces the broader effects of the full protein in living tissue remains an open question, and findings from animal models are frequently cited without a clear bridge to human physiology.
Discussion of TB-500 appears in several distinct literatures that rarely cite one another. Peer-reviewed studies usually describe in vitro assays or small animal experiments and are cautious about extrapolation. Veterinary and sports communities circulate anecdotal reports with limited methodological detail. Commercial listings add a third layer, often using the name interchangeably with thymosin beta-4 even though the two molecules differ in size and sequence. Regulatory status varies by country, and the compound is not a licensed medicine in most jurisdictions, so readers comparing sources should check which molecule and which purity each source actually describes.
TB-500 is a synthetic seven-residue peptide whose sequence, LKKTETQ, matches the N-terminal actin-binding region of thymosin beta-4. It is usually supplied in an N-terminally acetylated form, a modification that blocks the free amino terminus and can influence behavior in solution. In the research literature the same sequence appears under several names, including thymosin beta-4 fragment and shortened thymosin beta-4. Because it is a short peptide rather than the full 43-residue parent protein, its measured properties differ from those reported for thymosin beta-4 as a whole, and the two are not interchangeable in experimental design.
Identity and purity are assessed with a small set of standard techniques. Reverse-phase high-performance liquid chromatography gives a purity estimate from peak area, usually recorded at 214 or 220 nanometers, where the peptide bond absorbs. Mass spectrometry confirms the expected molecular mass and can reveal truncated or oxidized species. Amino acid analysis or tandem mass spectrometry sequencing can verify the sequence itself. Additional quality attributes include water content, residual trifluoroacetic acid carried over from purification, and endotoxin where the material is intended for biological work.
The compound is most often distributed as a lyophilized powder, appearing white to off-white and forming a loose cake or fluffy solid. It is hygroscopic to some degree, so brief exposure to humid air can add water weight and complicate weighing. The peptide dissolves readily in water and in neutral aqueous buffers, and aqueous solubility is generally described as high, well above the concentrations used in typical assays. Some polar organic solvents are also usable, which matters when a concentrated stock is prepared before dilution into buffer.
Storage recommendations center on keeping the dry powder cold, dry, and dark. A freezer at -20 degrees Celsius or below is conventional, and desiccant is often included to limit moisture uptake. Once dissolved, the peptide is less stable, and solutions are typically kept frozen and thawed only once. Repeated freeze-thaw cycles are a common source of losses because they promote aggregation and adsorption to container surfaces. Working aliquots are therefore prepared in advance, and glass or low-binding plastic is usually preferred over ordinary laboratory plastic.
Thymosin beta-4 contains 43 amino acids and has a reported molecular mass near 4963 Da. The short fragment most often associated with the TB-500 label, an acetylated chain beginning LKKTETQ, has a reported mass near 889 Da, so the two are easily separated in analytical work. Mass spectrometry and amino acid analysis can confirm which material is present in a given sample. Statements treating TB-500 and thymosin beta-4 as interchangeable are therefore imprecise, even though the two appear together in much of the same literature.
Interest in the compound comes largely from studies of the parent protein, which participates in actin sequestration, cell migration and tissue repair processes. Whether a short fragment reproduces those activities is a separate question that remains open in the published record. Many summaries describe mechanisms by analogy to thymosin beta-4 rather than from direct measurements on the fragment. Claims about activity should be treated as provisional unless a cited study specifies the exact peptide, its purity and the assay used.
In Australia, PLEs are shown on Main Event. In the United Kingdom and Ireland, all PLEs were shown on Sky Sports Box Office until 2019, when BT Sport took over rights to WWE content. In India and South Asia, a single broadcaster (currently Sony Ten) generally holds the rights to all WWE programming, with PLEs broadcast for no additional charge. Currently, WWE's PLEs for the Raw and SmackDown brands are generally held on Saturdays and are typically 3 to 4 hours in length, with some events running longer or shorter. NXT's PLEs have also mostly shifted to Saturdays and last between 2 to 3 hours. Prior to 2022, all PLEs were generally held on Sundays. The change was attributed to WWE president Nick Khan who felt that "big sports events were better on Saturday nights". WWE also airs a pre-show before most events which includes interviews, match previews, and a panel of experts analyzing the upcoming line-up. They were originally simply called Pre-Show, but beginning with Payback 2013, they were rebranded as Kickoff (although WrestleMania XXX in 2014 used the Pre-Show branding) before being rebranded again to WWE Countdown to [event] beginning with NXT Stand & Deliver in 2024. The pre-shows also used to host some matches but these were phased out in early 2022, although some pre-shows still occasionally have matches. WWE also airs a post-show media press conference following some events, including NXT events. Previously, they would air a post-show for some events, known as Fallout. Each Fallout included interviews and a panel of experts analyzing the event.
=== Theft === Radioactive materials in RTGs are dangerous and can be used for malicious purposes. They are not useful for a genuine nuclear weapon, but still can serve in a "dirty bomb". The Soviet Union constructed many uncrewed lighthouses and navigation beacons powered by RTGs using strontium-90 (90Sr). They are very reliable and provide a steady source of power. Most have no protection, not even fences or warning signs, and the locations of some of these facilities are no longer known due to poor record keeping. In one instance, the radioactive compartments were opened by a thief. In another case, three woodsmen in Tsalenjikha Region, Georgia found two ceramic RTG orphan sources that had been stripped of their shielding; two of the woodsmen were later hospitalized with severe radiation burns after carrying the sources on their backs, and the third died. The units were eventually recovered and isolated. There are about 1,000 such RTGs in Russia, all of which have long since exceeded their designed operational lives of ten years. Most of these RTGs likely no longer function, and may need to be dismantled. Some of their metal casings have been stripped by metal hunters, despite the risk of radioactive contamination. Transforming the radioactive material into an inert form reduces the danger of theft by people unaware of the radiation hazard (such as happened in the Goiânia accident in an abandoned Cs-137 source where the caesium was present in easily water-soluble caesium chloride form).
Steroidal antiandrogens are antiandrogens that resemble steroid hormones like testosterone and progesterone in chemical structure. They are the most commonly used antiandrogens in transgender women. Spironolactone (Aldactone), which is relatively safe and inexpensive, is the most frequently used antiandrogen in the United States. Cyproterone acetate (Androcur), which is unavailable in the United States, is widely used in Europe, Canada, and the rest of the world. Medroxyprogesterone acetate (Provera, Depo-Provera), a similar medication, is sometimes used in place of cyproterone acetate in the United States.
Sources: en.wikipedia.org
In pre-life, a 31 nucleotide D loop minihelix (GCGGCGGUAGCCUAGCCUAGCCUACCGCCGC) was ligated to two 31 nucleotide anticodon loop minihelices (GCGGCGGCCGGGCU/???AACCCGGCCGCCGC; / indicates a U-turn conformation in the RNA backbone; ? indicates unknown base identity) to form the 93 nucleotide tRNA precursor. To generate type II tRNAs, a single internal 9 nucleotide deletion occurred within ligated acceptor stems (CCGCCGCGCGGCGG goes to GGCGG). To generate type I tRNAs, an additional, related 9 nucleotide deletion occurred within ligated acceptor stems within the variable loop region (CCGCCGCGCGGCGG goes to CCGCC). These two 9 nucleotide deletions are identical on complementary RNA strands. tRNAomes (all of the tRNAs of an organism) were generated by duplication and mutation. Very clearly, life evolved from a polymer world that included RNA repeats and RNA inverted repeats (stem-loop-stems). Of particular importance were the 7 nucleotide U-turn loops (CU/???AA). After LUCA (the last universal common (cellular) ancestor), the T loop evolved to interact with the D loop at the tRNA "elbow" (T loop: UU/CAAAU, after LUCA). Polymer world progressed to minihelix world to tRNA world, which has endured for ~4 billion years. Analysis of tRNA sequences reveals a major successful pathway in evolution of life on Earth.
He'd say, 'Hey, I did this. Not you.'" Starr still blamed himself for the death of Staley, and had kept the story a secret until his appearance on Celebrity Rehab. During this same interview, Staley's mother recalled that he had attempted rehab fourteen times, although it is not clear whether any of these attempts were during his reclusive years. Starr was found dead on March 8, 2011, as a result of a prescription drug overdose.
=== Legal status === Omaveloxolone was approved for medical use in the United States in February 2023. In December 2023, the Committee for Medicinal Products for Human Use (CHMP) of the European Medicines Agency adopted a positive opinion, recommending the granting of a marketing authorization for the medicinal product Skyclarys, intended for the treatment of Friedreich's ataxia. The applicant for this medicinal product is Reata Ireland Limited. Omaveloxolone was approved for medical use in the European Union in February 2024.
Granzymes are serine proteases released by cytoplasmic granules within cytotoxic T cells and natural killer (NK) cells. They induce programmed cell death (apoptosis) in the target cell, thus eliminating cells that have become cancerous or are infected with viruses or bacteria. Granzymes also kill bacteria and inhibit viral replication. In NK cells and T cells, granzymes are packaged in cytotoxic granules along with perforin. Granzymes can also be detected in the rough endoplasmic reticulum, golgi complex, and the trans-golgi reticulum. The contents of the cytotoxic granules function to permit entry of the granzymes into the target cell cytosol. The granules are released into an immune synapse formed with a target cell, where perforin mediates the delivery of the granzymes into endosomes in the target cell, and finally into the target cell cytosol. Granzymes are part of the serine esterase family. They are closely related to other immune serine proteases expressed by innate immune cells, such as neutrophil elastase and cathepsin G. Granzyme B activates apoptosis by activating caspases (especially caspase-3), which cleaves many substrates, including caspase-activated DNase to execute cell death. Granzyme B also cleaves the protein Bid, which recruits the proteins Bax and Bak to change the membrane permeability of the mitochondria, causing the release of cytochrome c (which is one of the parts needed to activate caspase-9 via the apoptosome), Smac/Diablo and Omi/HtrA2 (which suppress the inhibitor of apoptosis proteins (IAPs)), among other proteins.
Sources: en.wikipedia.org
Usually not, though usage overlaps. The label most often refers to a short acetylated fragment of the parent protein, while thymosin beta-4 itself is the full 43-residue molecule. Because suppliers vary, a sequence statement is needed to settle the question for any particular lot.
The name is a commercial label rather than a systematic chemical designation, so different vendors and papers attach it to different sequences. Some treat it as a fragment and others as the whole protein. Comparing two reports therefore requires checking what each one actually analyzed.
Typically it reflects the relative area of the main peak in a reversed-phase chromatogram at a given wavelength. It does not confirm the amino acid sequence, the counter-ion, or the amount of peptide by mass. Identity is normally established by a separate mass measurement.
The leading proposal involves sequestration of monomeric actin, which would alter cytoskeletal turnover and cell movement. The actin-binding motif shared with the parent protein is central to that idea. Direct confirmation in whole organisms remains limited.